| Basic information from miRBase |
| hairpin accession number: MI0007546 |
| Located between position 18252173 and 18252252 on chromosome 5 strand - |
| Overlapping with sense strand of (intron 10). |
| (Ensemble: ENSGALT00000012172) |
| mature miRNAs for MI0007546: |
| gga-miR-1802 (MIMAT0007718): CAGTGACTGCTTTTGTGCTTAT |
| You can find this miRNA in ENTREZGENE: MIR1802 (accession: 100315848) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |