| Basic information from miRBase |
| hairpin accession number: MI0007549 |
| Located between position 47863649 and 47863731 on chromosome 4 strand + |
| Overlapping with sense strand of HNRDL_CHICK (intron 3). |
| (Ensemble: ENSGALT00000018235) |
| mature miRNAs for MI0007549: |
| gga-miR-1804 (MIMAT0007721): TCAGAAGTTGTGAAAGCTGCAG |
| You can find this miRNA in ENTREZGENE: MIR1804 (accession: 100315850) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |