| Basic information from miRBase |
| hairpin accession number: MI0007550 |
| Located between position 135141607 and 135141690 on chromosome 1 strand - |
| Overlapping with sense strand of GABRG3 (intron 5). |
| (Ensemble: ENSGALT00000030259) |
| mature miRNAs for MI0007550: |
| gga-miR-1805-5p (MIMAT0007722): GAGTTGTAGTCTTTCAAACAGA |
| gga-miR-1805-3p (MIMAT0007723): TGTATTGGAACACTACAGCTC |
| You can find this miRNA in ENTREZGENE: MIR1805 (accession: 100316000) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |