| Basic information from miRBase |
| hairpin accession number: MI0007551 |
| Located between position 97200876 and 97200960 on chromosome 1 strand - |
| mature miRNAs for MI0007551: |
| gga-miR-1806 (MIMAT0007724): AGGCAGGATCACAAGGTCTGGA |
| You can find this miRNA in ENTREZGENE: MIR1806 (accession: 100315900) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |