| Basic information from miRBase |
| hairpin accession number: MI0007556 |
| Located between position 58651698 and 58651778 on chromosome 4 strand + |
| Overlapping with antisense strand of LARP7 (intron 9). |
| (Ensemble: ENSGALT00000019679) |
| mature miRNAs for MI0007556: |
| gga-miR-1811 (MIMAT0007729): TATTGCAGCGCTGGGTGCAT |
| You can find this miRNA in ENTREZGENE: MIR1811 (accession: 100316001) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |