| Basic information from miRBase |
| hairpin accession number: MI0007557 |
| Located between position 1263807 and 1263894 on chromosome 7 strand - |
| mature miRNAs for MI0007557: |
| gga-miR-1812 (MIMAT0007730): ATATATACTGTATACTGTGTCA |
| You can find this miRNA in ENTREZGENE: MIR1812 (accession: 100316017) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |