| Basic information from miRBase |
| hairpin accession number: MI0007370 |
| Located between position 61722590 and 61722663 on chromosome 4 strand + |
| mature miRNAs for MI0007370: |
| gga-miR-1814 (MIMAT0007513): AGGTTGTTTGGTTTTGTTTT |
| You can find this miRNA in ENTREZGENE: MIR1814 (accession: 100315757) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |