| Basic information from miRBase |
| hairpin accession number: MI0007369 |
| Located between position 29566734 and 29566810 on chromosome 6 strand + |
| mature miRNAs for MI0007369: |
| gga-miR-1815 (MIMAT0007512): TAGGTTTTATGGTTTTGTTTT |
| You can find this miRNA in ENTREZGENE: MIR1815 (accession: 100315756) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |