| Basic information from miRBase |
| hairpin accession number: MI0007490 |
| Located between position 90603851 and 90603955 on chromosome 2 strand + |
| Overlapping with sense strand of GABBR2 (intron 11). |
| (Ensemble: ENSGALT00000021562) |
| mature miRNAs for MI0007490: |
| gga-miR-1816 (MIMAT0007656): GTAGGTTTTGTGGTTTTGTT |
| You can find this miRNA in ENTREZGENE: MIR1816 (accession: 100315819) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |