| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001247 |
| Located between position 8107831 and 8107901 on chromosome 20 strand + |
| mature miRNAs for MI0001247: |
| gga-miR-1a (MIMAT0001127): TGGAATGTAAAGAAGTATGTA |
| You can find this miRNA in ENTREZGENE: (accession: 777851) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| more data |
| Data from CoGemiR |