| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001254 |
| Located between position 4663912 and 4663975 on chromosome 23 strand + |
| Overlapping with sense strand of Q6IEC6_CHICK (intron 1). |
| (Ensemble: ENSGALT00000040849) |
| mature miRNAs for MI0001254: |
| gga-miR-1b (MIMAT0001175): TGGAATGTTAAGAAGTATGTA |
| You can find this miRNA in ENTREZGENE: (accession: 777858) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| more data |
| Data from CoGemiR |