| Basic information from miRBase |
| hairpin accession number: MI0007361 |
| Located between position 36625855 and 36625928 on chromosome 7 strand + |
| mature miRNAs for MI0007361: |
| gga-miR-1c (MIMAT0007503): TGGAATGGAAAGCAGTATGTAT |
| You can find this miRNA in ENTREZGENE: MIR1C (accession: 100315965) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |