miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001181
Located between position 152248306 and 152248403 on chromosome 1 strand -
mature miRNAs for MI0001181:
         gga-miR-20a (MIMAT0001111): TAAAGTGCTTATAGTGCAGGTAG
You can find this miRNA in ENTREZGENE: (accession: 777935)

References
[1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution"
[2]McBride D, Carre W, Law A, Clinton M, Unpublished.,
[3]Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V, J Virol. 82:4007-4015(2008)., "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"


more data
Data from CoGemiR