miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0001517

Located between position 3970047 and 3970131 on chromosome 4 strand -

mature miRNAs for MI0001517:

gga-miR-20b (MIMAT0001411): CAAAGTGCTCATAGTGCAGGTAG

You can find this miRNA in ENTREZGENE: MIR20B (accession: 777891)

References

[1]Hubbard SJ, Grafham DV, Beattie KJ, Overton IM, McLaren SR, Croning MD, Boardman PE, Bonfield JK, Burnside J, Davies RM, Farrell ER, Francis MD, Griffiths-Jones S, Humphray SJ, Hyland C, Scott CE, Tang H, Taylor RG, Tickle C, Brown WR, Birney E, Rogers J,, Genome Res. 15:174-183(2005)., "Transcriptome analysis for the chicken based on 19,626 finished cDNA sequences and 485,337 expressed sequence tags"

[2]McBride D, Carre W, Law A, Clinton M, Unpublished.,

[3]Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V, J Virol. 82:4007-4015(2008)., "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"

more data

Data from CoGemiR