| Basic information from miRBase |
| hairpin accession number: MI0010732 |
| Located between position 170154815 and 170154918 on chromosome 1 strand + |
| mature miRNAs for MI0010732: |
| gga-miR-2127 (MIMAT0011203): CGGGAGGGGAGGGAGGGCGGG |
| You can find this miRNA in ENTREZGENE: MIR2127 (accession: 100315863) |
| References |
| [1]Rathjen T, Pais H, Sweetman D, Moulton V, Munsterberg A, Dalmay T, FEBS Lett. 583:1422-1426(2009)., "High throughput sequencing of microRNAs in chicken somites" |