| Basic information from miRBase |
| hairpin accession number: MI0010733 |
| Located between position 1811806 and 1811869 on chromosome 10 strand - |
| Overlapping with sense strand of LOC415311 (intron 1). |
| (Ensemble: ENSGALT00000002612) |
| mature miRNAs for MI0010733: |
| gga-miR-2128 (MIMAT0011204): TGCAGTGACGTCTCTTCCCC |
| You can find this miRNA in ENTREZGENE: MIR2128 (accession: 100315864) |
| References |
| [1]Rathjen T, Pais H, Sweetman D, Moulton V, Munsterberg A, Dalmay T, FEBS Lett. 583:1422-1426(2009)., "High throughput sequencing of microRNAs in chicken somites" |