Basic information from miRBase |
hairpin accession number: MI0010736 |
Located between position 68816728 and 68816816 on chromosome Z strand - |
Overlapping with sense strand of NCBP1_CHICK (intron 21). |
(Ensemble: ENSGALT00000003255) |
mature miRNAs for MI0010736: |
gga-miR-2131 (MIMAT0011207): ATGCAGAAGTGCACGGAAACAGCT |
You can find this miRNA in ENTREZGENE: MIR2131 (accession: 100315939) |
References |
[1]Rathjen T, Pais H, Sweetman D, Moulton V, Munsterberg A, Dalmay T, FEBS Lett. 583:1422-1426(2009)., "High throughput sequencing of microRNAs in chicken somites" |