| Basic information from miRBase |
| hairpin accession number: MI0015374 |
| Located between position 2684926 and 2685094 on chromosome 22 strand - |
| Overlapping with sense strand of Q90715_CHICK (intron 2). |
| (Ensemble: ENSGALT00000005683) |
| mature miRNAs for MI0015374: |
| gga-miR-2188 (MIMAT0016372): AAGGTCCAACCTCACATGTCCT |
| You can find this miRNA in ENTREZGENE: MIR2188 (accession: 100498679) |
| References |
| [1]Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H, BMC Genomics. 10:512(2009)., "Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach" |