| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001266 |
| Located between position 2512569 and 2512648 on chromosome 26 strand - |
| mature miRNAs for MI0001266: |
| gga-miR-29b (MIMAT0001097): TAGCACCATTTGAAATCAGTGTT |
| You can find this miRNA in ENTREZGENE: (accession: 777870) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| [2]Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V, J Virol. 82:4007-4015(2008)., "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" |
| more data |
| Data from CoGemiR |