miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001199
Located between position 148331598 and 148331684 on chromosome 2 strand -
mature miRNAs for MI0001199:
         gga-miR-30b (MIMAT0001130): TGTAAACATCCTACACTCAGCT
You can find this miRNA in ENTREZGENE: (accession: 777803)

References
[1]Xu H, Wang X, Du Z, Li N, FEBS Lett. 580:3610-3616(2006)., "Identification of microRNAs from different tissues of chicken embryo and adult chicken"
[2]McBride D, Carre W, Law A, Clinton M, Unpublished.,
[3]Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V, J Virol. 82:4007-4015(2008)., "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"
[4]Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ, Genome Res. 18:995-1004(2008)., "Conservation of small RNA pathways in platypus"


more data
Data from CoGemiR