miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0001257

Located between position 5249637 and 5249725 on chromosome 23 strand +

Overlapping with sense strand of NFYC (intron 4).

(Ensemble: ENSGALT00000035036)

mature miRNAs for MI0001257:

gga-miR-30c (MIMAT0001137): TGTAAACATCCTACACTCTCAGCT

You can find this miRNA in ENTREZGENE: (accession: 777861)

References

[1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution"

[2]Xu H, Wang X, Du Z, Li N, FEBS Lett. 580:3610-3616(2006)., "Identification of microRNAs from different tissues of chicken embryo and adult chicken"

[3]McBride D, Carre W, Law A, Clinton M, Unpublished.,

[4]Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V, J Virol. 82:4007-4015(2008)., "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"

more data

Data from CoGemiR