| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001194 |
| Located between position 86506451 and 86506520 on chromosome 2 strand - |
| Overlapping with sense strand of (intron 23). |
| (Ensemble: ENSGALT00000021448) |
| mature miRNAs for MI0001194: |
| gga-miR-32 (MIMAT0001125): TATTGCACATTACTAAGTTGC |
| You can find this miRNA in ENTREZGENE: (accession: 777798) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| more data |
| Data from CoGemiR |