| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001170 |
| Located between position 51372282 and 51372350 on chromosome 1 strand - |
| Overlapping with sense strand of Q9I8H7_CHICK (intron 13). |
| (Ensemble: ENSGALT00000019442) |
| mature miRNAs for MI0001170: |
| gga-miR-33 (MIMAT0001100): GTGCATTGTAGTTGCATTGC |
| You can find this miRNA in ENTREZGENE: (accession: 777924) |
| References |
| [1]Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ, Genome Res. 18:995-1004(2008)., "Conservation of small RNA pathways in platypus" |
| [2]Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V, J Virol. 82:4007-4015(2008)., "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" |
| more data |
| Data from CoGemiR |