| Basic information from miRBase |
| hairpin accession number: MI0015379 |
| Located between position 8404342 and 8404438 on chromosome 17 strand + |
| Overlapping with sense strand of SNORA17 (exon 1). |
| (Ensemble: ENSGALT00000042574) RFAM: RFAM) |
| mature miRNAs for MI0015379: |
| gga-miR-3528 (MIMAT0016377): CATGCCCCAGTCGTGTTGCAGA |
| You can find this miRNA in ENTREZGENE: MIR3528 (accession: 100498684) |
| References |
| [1]Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H, BMC Genomics. 10:512(2009)., "Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach" |