| Basic information from miRBase |
| hairpin accession number: MI0015380 |
| Located between position 14823529 and 14823619 on chromosome 10 strand + |
| mature miRNAs for MI0015380: |
| gga-miR-3529 (MIMAT0016378): AGGCAGACTGTGACTTGTTGT |
| You can find this miRNA in ENTREZGENE: MIR3529 (accession: 100498685) |
| References |
| [1]Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H, BMC Genomics. 10:512(2009)., "Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach" |