| Basic information from miRBase |
| hairpin accession number: MI0015387 |
| Located between position 32350014 and 32350095 on chromosome Un_random strand - |
| mature miRNAs for MI0015387: |
| gga-miR-3534 (MIMAT0016385): TGTGGGTTGACAGTGCTGAGGT |
| You can find this miRNA in ENTREZGENE: MIR3534 (accession: 100498692) |
| References |
| [1]Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H, BMC Genomics. 10:512(2009)., "Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach" |