| Basic information from miRBase |
| hairpin accession number: MI0015389 |
| Located between position 1478485 and 1478562 on chromosome 25 strand + |
| Overlapping with sense strand of UBAP2L (intron 13). |
| (Ensemble: ENSGALT00000040674) |
| mature miRNAs for MI0015389: |
| gga-miR-3536 (MIMAT0016387): CTGCATACGAGTAGACCCTTTC |
| You can find this miRNA in ENTREZGENE: MIR3536 (accession: 100498694) |
| References |
| [1]Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H, BMC Genomics. 10:512(2009)., "Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach" |