| Basic information from miRBase |
| hairpin accession number: MI0015390 |
| Located between position 18024717 and 18024793 on chromosome 6 strand + |
| Overlapping with sense strand of NFKB2_CHICK (3UTR 8). |
| (Ensemble: ENSGALT00000009068) |
| mature miRNAs for MI0015390: |
| gga-miR-3537 (MIMAT0016388): GTGAGTGCTGTAGGATGGGGCTC |
| You can find this miRNA in ENTREZGENE: MIR3537 (accession: 100498695) |
| References |
| [1]Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H, BMC Genomics. 10:512(2009)., "Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach" |