| Basic information from miRBase |
| hairpin accession number: MI0015394 |
| Located between position 12751614 and 12751675 on chromosome 10 strand + |
| Overlapping with sense strand of SCARNA15 (exon 1). |
| (Ensemble: ENSGALT00000042527) RFAM: RFAM) |
| mature miRNAs for MI0015394: |
| gga-miR-3540 (MIMAT0016391): ATGGTGGAAGAACAAGGCCTGC |
| You can find this miRNA in ENTREZGENE: MIR3540 (accession: 100498699) |
| References |
| [1]Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H, BMC Genomics. 10:512(2009)., "Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach" |