| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001269 |
| Located between position 4436025 and 4436119 on chromosome 28 strand - |
| mature miRNAs for MI0001269: |
| gga-miR-7 (MIMAT0001157): TGGAAGACTAGTGATTTTGTTG |
| You can find this miRNA in ENTREZGENE: (accession: 777873) |
| References |
| [1]McBride D, Carre W, Law A, Clinton M, Unpublished., |
| [2]Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ, Genome Res. 18:995-1004(2008)., "Conservation of small RNA pathways in platypus" |
| [3]Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V, J Virol. 82:4007-4015(2008)., "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" |
| more data |
| Data from CoGemiR |