| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0001173 |
| Located between position 102424333 and 102424413 on chromosome 1 strand + |
| Overlapping with sense strand of (intron 7). |
| (Ensemble: ENSGALT00000030387) |
| mature miRNAs for MI0001173: |
| gga-miR-99a (MIMAT0001103): AACCCGTAGATCCGATCTTGTG |
| gga-miR-99a* (MIMAT0006781): CAAGCTCGCTTCTATGGGTCT |
| You can find this miRNA in ENTREZGENE: (accession: 777927) |
| References |
| [1]International Chicken Genome Sequencing Consortium, Nature. 432:695-716(2004)., "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" |
| [2]McBride D, Carre W, Law A, Clinton M, Unpublished., |
| [3]Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH, Gene. 418:34-40(2008)., "Identification of novel chicken microRNAs and analysis of their genomic organization" |
| more data |
| Data from CoGemiR |