miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013552
mature miRNAs for MI0013552:
         ghr-miR2949a (MIMAT0014345): ACTTTTGAACTGGATTTGCCGA
         ghr-miR2949a* (MIMAT0015374): TGCAAATCCAGTCAAAAGTTA

References
[1]Pang M, Woodward AW, Agarwal V, Guan X, Ha M, Ramachandran V, Chen X, Triplett BA, Stelly DM, Chen ZJ, Genome Biol. 10:R122(2009)., "Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L.)"
[2]Kwak PB, Wang QQ, Chen XS, Qiu CX, Yang ZM, BMC Genomics. 10:457(2009)., "Enrichment of a set of microRNAs during the cotton fiber development"