| Basic information from miRBase |
| hairpin accession number: MI0013536 |
| mature miRNAs for MI0013536: |
| gra-miR482 (MIMAT0014329): TCTTTCCAATTCCTCCCATTCC |
| References |
| [1]Pang M, Woodward AW, Agarwal V, Guan X, Ha M, Ramachandran V, Chen X, Triplett BA, Stelly DM, Chen ZJ, Genome Biol. 10:R122(2009)., "Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L.)" |