miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0000109

Located between position 167987901 and 167987978 on chromosome 5 strand -

Overlapping with sense strand of PANK3-003 (intron 2).

(Ensemble: OTTHUMT00000371464)

mature miRNAs for MI0000109:

hsa-miR-103a (MIMAT0000101): AGCAGCATTGTACAGGGCTATGA

You can find this miRNA in EMBL: AF480545 (accession: AF480545)

References

[1]Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G, Genes Dev. 16:720-728(2002)., "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"

[2]Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS, Dev Biol. 270:488-498(2004)., "Human embryonic stem cells express a unique set of microRNAs"

[3]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"

[4]Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer"

[5]Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V, BMC Genomics. 11 Suppl 1:S6(2010)., "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha"