miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0007261
Located between position 167987909 and 167987970 on chromosome 5 strand +
Overlapping with antisense strand of PANK3-003 (intron 2).
(Ensemble: OTTHUMT00000371464)
mature miRNAs for MI0007261:
         hsa-miR-103b (MIMAT0007402): TCATAGCCCTGTACAATGCTGCT
You can find this miRNA in HGNC: MIR103-1AS (accession: 35384)

References
[1]Azuma-Mukai A, Oguri H, Mituyama T, Qian ZR, Asai K, Siomi H, Siomi MC, Proc Natl Acad Sci U S A. 105:7964-7969(2008)., "Characterization of endogenous human Argonautes and their miRNA partners in RNA silencing"


more data
Expression data from dbDEMC