Basic information from miRBase |
hairpin accession number: MI0007261 |
Located between position 167987909 and 167987970 on chromosome 5 strand + |
Overlapping with antisense strand of PANK3-003 (intron 2). |
(Ensemble: OTTHUMT00000371464) |
mature miRNAs for MI0007261: |
hsa-miR-103b (MIMAT0007402): TCATAGCCCTGTACAATGCTGCT |
You can find this miRNA in HGNC: MIR103-1AS (accession: 35384) |
References |
[1]Azuma-Mukai A, Oguri H, Mituyama T, Qian ZR, Asai K, Siomi H, Siomi MC, Proc Natl Acad Sci U S A. 105:7964-7969(2008)., "Characterization of endogenous human Argonautes and their miRNA partners in RNA silencing" |
more data |
Expression data from dbDEMC |