| PROMOTER INFORMATION | ||||||||||||||
| 459 | chrX, 151370386-151370586, - | promoter sequence | Marson et al. |  | | |||||||||
| 871 | chrX, 151313540-151318620, - | promoter sequence | UCSC | | | |||||||||
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |
| Basic information from miRBase |
| hairpin accession number: MI0000112 |
| Located between position 151562884 and 151562964 on chromosome X strand - |
| Overlapping with sense strand of GABRA3-002 (intron 1). |
| (Ensemble: OTTHUMT00000060922) |
| mature miRNAs for MI0000112: |
| hsa-miR-105 (MIMAT0000102): TCAAATGCTCAGACTCCTGTGGT |
| hsa-miR-105* (MIMAT0004516): ACGGATGTTTGAGCATGTGCTA |
| You can find this miRNA in EMBL: AF480548 (accession: AF480548) |
| References | ||||||||||||||
| [1]Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G, Genes Dev. 16:720-728(2002)., "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" | ||||||||||||||
| [2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 459 | chrX, 151370386-151370586, - | promoter sequence | Marson et al. | | | |||||||||
| 871 | chrX, 151313540-151318620, - | promoter sequence | UCSC | | | |||||||||
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |