| Basic information from miRBase |
| hairpin accession number: MI0000114 |
| Located between position 91352504 and 91352584 on chromosome 10 strand - |
| Overlapping with sense strand of PANK1-002 (intron 4). |
| (Ensemble: OTTHUMT00000049318) |
| mature miRNAs for MI0000114: |
| hsa-miR-107 (MIMAT0000104): AGCAGCATTGTACAGGGCTATCA |
| You can find this miRNA in EMBL: (accession: AF480550) |
| References | ||||||||||||||
[1]Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G, Genes Dev. 16:720-728(2002)., "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"  | ||||||||||||||
| [2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 140 | chr10, 91395209-91395409, - | promoter sequence | Marson et al. |  | | |||||||||
| 888 | chr10, 91342484-91347564, - | promoter sequence | UCSC | | | |||||||||
| 1268 | chr10, 91382845-91387844, - | promoter sequence | Corcoran et al. | | | |||||||||
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |
| Pathway information from dPORE-miRNA |