miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000446
Located between position 121970465 and 121970552 on chromosome 11 strand -
Overlapping with sense strand of RP11-166D19.1-008 (intron 1).
(Ensemble: OTTHUMT00000387652)
mature miRNAs for MI0000446:
         hsa-miR-125b (MIMAT0000423): TCCCTGAGACCCTAACTTGTGA
         hsa-miR-125b-1* (MIMAT0004592): ACGGGTTAGGCTCTTGGGAGCT
You can find this miRNA in TARGETS:PICTAR-VERT: hsa-miR-125b (accession: hsa-miR-125b)

References
[1]Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T, Curr Biol. 12:735-739(2002)., "Identification of tissue-specific microRNAs from mouse"
[2]Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR, Proc Natl Acad Sci U S A. 102:5570-5575(2005)., "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells"
[3]Lee YS, Kim HK, Chung S, Kim KS, Dutta A, J Biol Chem. 280:16635-16641(2005)., "Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cells but not for the down-regulation of putative targets during differentiation"
[4]Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X, FEBS Lett. 579:3849-3854(2005)., "Identification of human fetal liver miRNAs by a novel method"
[5]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[6]Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer"
[7]Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V, BMC Genomics. 11 Suppl 1:S6(2010)., "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha"


PROMOTER INFORMATION
PROMOTER ID
LOCALIZATION
SEQUENCE
REFERENCE
SNP
TFBS
88 chr11, 121475784-121476133, - promoter sequence Zhou et al.
158 chr11, 121476269-121476469, - promoter sequence Marson et al.
470 chr11, 121477545-121477931, - promoter sequence Fujita et al.
921 chr11, 121475675-121480762, - promoter sequence UCSC


more data
Expression data from dbDEMC
Expression data from PhenomiR