| PROMOTER INFORMATION | ||||||||||||||
| 983 | chr14, 100414069-100419165, + | promoter sequence | UCSC |  | | |||||||||
This microRNA is imprinted (based on ncRNAimprinted database) |
| more data |
| Expression data from PhenomiR |
| Basic information from miRBase |
| hairpin accession number: MI0000472 |
| Located between position 101349316 and 101349412 on chromosome 14 strand + |
| Overlapping with antisense strand of RTL1-001 (exon 1). |
| (Ensemble: OTTHUMT00000395127) |
| mature miRNAs for MI0000472: |
| hsa-miR-127-5p (MIMAT0004604): CTGAAGCTCAGAGGGCTCTGAT |
| hsa-miR-127-3p (MIMAT0000446): TCGGATCCGTCTGAGCTTGGCT |
| You can find this miRNA in TARGETS:PICTAR-VERT: hsa-miR-127 (accession: hsa-miR-127) |
| References | ||||||||||||||
| [1]Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T, Curr Biol. 12:735-739(2002)., "Identification of tissue-specific microRNAs from mouse" | ||||||||||||||
| [2]Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H, Nucleic Acids Res. 33:2697-2706(2005)., "Clustering and conservation patterns of human microRNAs" | ||||||||||||||
| [3]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
| [4]Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F, BMC Genomics. 9:52(2008)., "New miRNAs cloned from neuroblastoma" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 983 | chr14, 100414069-100419165, + | promoter sequence | UCSC | | | |||||||||
This microRNA is imprinted (based on ncRNAimprinted database) |
| more data |
| Expression data from PhenomiR |