| Basic information from miRBase |
| hairpin accession number: MI0016057 |
| Located between position 112475403 and 112475519 on chromosome 12 strand - |
| Overlapping with sense strand of NAA25-201 (intron 22). |
| (Ensemble: ENST00000261745) |
| mature miRNAs for MI0016057: |
| hsa-miR-3657 (MIMAT0018077): TGTGTCCCATTATTGGTGATT |
| You can find this miRNA in ENTREZGENE: MIR3657 (accession: 100500889) |
| References |
| [1]Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E, Nucleic Acids Res. 38:6234-6246(2010)., "Discovery of microRNAs and other small RNAs in solid tumors" |