| Basic information from miRBase |
| hairpin accession number: MI0016058 |
| Located between position 165877158 and 165877213 on chromosome 1 strand + |
| Overlapping with sense strand of UCK2-008 (exon 3). |
| (Ensemble: OTTHUMT00000096760) |
| mature miRNAs for MI0016058: |
| hsa-miR-3658 (MIMAT0018078): TTTAAGAAAACACCATGGAGAT |
| You can find this miRNA in ENTREZGENE: MIR3658 (accession: 100500832) |
| References |
| [1]Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E, Nucleic Acids Res. 38:6234-6246(2010)., "Discovery of microRNAs and other small RNAs in solid tumors" |