| Basic information from miRBase |
| hairpin accession number: MI0016060 |
| Located between position 38554903 and 38555001 on chromosome 1 strand + |
| Overlapping with sense strand of RP5-884C9.2-002 (intron 1). |
| (Ensemble: OTTHUMT00000001201) |
| mature miRNAs for MI0016060: |
| hsa-miR-3659 (MIMAT0018080): TGAGTGTTGTCTACGAGGGCA |
| You can find this miRNA in ENTREZGENE: MIR3659 (accession: 100500801) |
| References |
| [1]Hansen TB, Bramsen JB, Kjems J, PLoS One. 5:e10961(2010)., "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" |
| [2]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" |