| Basic information from miRBase |
| hairpin accession number: MI0016063 |
| Located between position 135300476 and 135300570 on chromosome 6 strand - |
| Overlapping with sense strand of HBS1L-008 (intron 10). |
| (Ensemble: OTTHUMT00000391467) |
| mature miRNAs for MI0016063: |
| hsa-miR-3662 (MIMAT0018083): GAAAATGATGAGTAGTGACTGATG |
| You can find this miRNA in ENTREZGENE: MIR3662 (accession: 100500880) |
| References |
| [1]Hansen TB, Bramsen JB, Kjems J, PLoS One. 5:e10961(2010)., "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" |