| Basic information from miRBase |
| hairpin accession number: MI0016064 |
| Located between position 118927189 and 118927285 on chromosome 10 strand - |
| Overlapping with sense strand of RP11-501J20.2-001 (intron 1). |
| (Ensemble: OTTHUMT00000050558) |
| mature miRNAs for MI0016064: |
| hsa-miR-3663-5p (MIMAT0018084): GCTGGTCTGCGTGGTGCTCGG |
| hsa-miR-3663-3p (MIMAT0018085): TGAGCACCACACAGGCCGGGCGC |
| You can find this miRNA in ENTREZGENE: MIR3663 (accession: 100500893) |
| References |
| [1]Hansen TB, Bramsen JB, Kjems J, PLoS One. 5:e10961(2010)., "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" |
| [2]Liao JY, Ma LM, Guo YH, Zhang YC, Zhou H, Shao P, Chen YQ, Qu LH, PLoS One. 5:e10563(2010)., "Deep sequencing of human nuclear and cytoplasmic small RNAs reveals an unexpectedly complex subcellular distribution of miRNAs and tRNA 3' trailers" |