| Basic information from miRBase |
| hairpin accession number: MI0016067 |
| Located between position 114293400 and 114293510 on chromosome 7 strand + |
| Overlapping with sense strand of FOXP2-016 (intron 9). |
| (Ensemble: OTTHUMT00000317368) |
| mature miRNAs for MI0016067: |
| hsa-miR-3666 (MIMAT0018088): CAGTGCAAGTGTAGATGCCGA |
| You can find this miRNA in ENTREZGENE: MIR3666 (accession: 100500896) |
| References |
| [1]Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M, Nature. 434:338-345(2005)., "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" |
| [2]Smith B, Treadwell J, Zhang D, Ly D, McKinnell I, Walker PR, Sikorska M, PLoS One. 5:e11109(2010)., "Large-scale expression analysis reveals distinct microRNA profiles at different stages of human neurodevelopment" |