| Basic information from miRBase |
| hairpin accession number: MI0016068 |
| Located between position 49937041 and 49937114 on chromosome 22 strand - |
| Overlapping with sense strand of C22orf34-005 (intron 1). |
| (Ensemble: OTTHUMT00000317434) |
| mature miRNAs for MI0016068: |
| hsa-miR-3667-5p (MIMAT0018089): AAAGACCCATTGAGGAGAAGGT |
| hsa-miR-3667-3p (MIMAT0018090): ACCTTCCTCTCCATGGGTCTTT |
| You can find this miRNA in ENTREZGENE: MIR3667 (accession: 100500882) |
| References |
| [1]Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A, BMC Genomics. 11:288(2010)., "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" |