| Basic information from miRBase |
| hairpin accession number: MI0016069 |
| Located between position 140526389 and 140526463 on chromosome 6 strand + |
| mature miRNAs for MI0016069: |
| hsa-miR-3668 (MIMAT0018091): AATGTAGAGATTGATCAAAAT |
| You can find this miRNA in ENTREZGENE: MIR3668 (accession: 100500879) |
| References |
| [1]Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A, BMC Genomics. 11:288(2010)., "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" |