| Basic information from miRBase |
| hairpin accession number: MI0016070 |
| Located between position 130509594 and 130509674 on chromosome 8 strand - |
| Overlapping with sense strand of RP11-3O20.1-003 (intron 1). |
| (Ensemble: OTTHUMT00000380582) |
| mature miRNAs for MI0016070: |
| hsa-miR-3669 (MIMAT0018092): ACGGAATATGTATACGGAATATA |
| You can find this miRNA in ENTREZGENE: MIR3669 (accession: 100500874) |
| References |
| [1]Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A, BMC Genomics. 11:288(2010)., "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" |