| Basic information from miRBase |
| hairpin accession number: MI0016072 |
| Located between position 65523438 and 65523525 on chromosome 1 strand - |
| mature miRNAs for MI0016072: |
| hsa-miR-3671 (MIMAT0018094): ATCAAATAAGGACTAGTCTGCA |
| You can find this miRNA in ENTREZGENE: MIR3671 (accession: 100500854) |
| References |
| [1]Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A, BMC Genomics. 11:288(2010)., "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" |