Basic information from miRBase |
hairpin accession number: MI0016902 |
Located between position 42319226 and 42319301 on chromosome 22 strand - |
mature miRNAs for MI0016902: |
hsa-miR-378i (MIMAT0019074): ACTGGACTAGGAGTCAGAAGG |
References |
[1]Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Yan Au W, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill , Blood. 116:e118-e127(2010)., "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" |
more data |
Expression data from dbDEMC |