| more data |
| Expression data from dbDEMC |
| Basic information from miRBase |
| hairpin accession number: MI0016902 |
| Located between position 42319226 and 42319301 on chromosome 22 strand - |
| mature miRNAs for MI0016902: |
| hsa-miR-378i (MIMAT0019074): ACTGGACTAGGAGTCAGAAGG |
| References |
| [1]Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Yan Au W, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill , Blood. 116:e118-e127(2010)., "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" |
| more data |
| Expression data from dbDEMC |